View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_444 (Length: 213)
Name: NF8208A_low_444
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_444 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 13804078 - 13803868
Alignment:
| Q |
1 |
tcaatggagtttgagatatacttttccttaaattgatagttggcattggtagattttgtgtatctccccatttgtcgtaaggcacaatatgcataggaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
13804078 |
tcaatggagtttgagatatacttttccttaaattgatagttggcattggtagattttgtgcatctccccatttgttgtaaggttcaatatgcataggaaa |
13803979 |
T |
|
| Q |
101 |
gtaaaaggaaaataagtaatcgatagtactaggcctagagtcttggtagataggtttggggaaatatttagtttcaatccatcattgtagcattacttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13803978 |
gtaaaaggaaaataagtaatcgatagtactaggcctagagtcttggtaggtaggtttggggaaatatttagtttcaatccatcattgtagcattacttgg |
13803879 |
T |
|
| Q |
201 |
gtattcttaca |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
13803878 |
gtattcttaca |
13803868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University