View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_445 (Length: 213)
Name: NF8208A_low_445
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_445 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 22 - 203
Target Start/End: Complemental strand, 8284858 - 8284677
Alignment:
| Q |
22 |
actacttcattaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcagtagggatgcgaaaataagcatcaactt |
121 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||||||| |
|
|
| T |
8284858 |
actacttcattaatatgattctgcacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggttccagtaggggtttgaaaataagcatcaactt |
8284759 |
T |
|
| Q |
122 |
ggttttggttcacggacaccgcgggtgaattagaaaacaccgccatcccatcattagcattagagtatccaatattattcga |
203 |
Q |
| |
|
||||||||||||| || || ||||||||||||||||||||| ||||||||||||||||||| ||| |||| ||||| ||||| |
|
|
| T |
8284758 |
ggttttggttcaccgagactgcgggtgaattagaaaacaccaccatcccatcattagcattggagaatccgatattgttcga |
8284677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 30 - 177
Target Start/End: Complemental strand, 34694900 - 34694753
Alignment:
| Q |
30 |
attaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcagtagggatgcgaaaataagcatcaacttggttttgg |
129 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||||||||||||||||| | ||||| |||| || || || ||||| |||| |||| |||||| |
|
|
| T |
34694900 |
attaatatgattctcaaccgggaaagaggaaaatgggggtgtaggtagttgtagaccggttccagtgagggtgtgaggataagtatcatcttgattttgg |
34694801 |
T |
|
| Q |
130 |
ttcacggacaccgcgggtgaattagaaaacaccgccatcccatcatta |
177 |
Q |
| |
|
|||| || | ||||||||||||| | || | |||||||||||||| |
|
|
| T |
34694800 |
ttcagagatattgcgggtgaattaggcaccatcaccatcccatcatta |
34694753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 27 - 94
Target Start/End: Complemental strand, 34686977 - 34686910
Alignment:
| Q |
27 |
ttcattaatatgattctccacagggaaagagaaaaatgggggtgtaggtagttgtaaatcggtttcag |
94 |
Q |
| |
|
|||||||||||||||||| || ||||||||| ||||||||||||||||||||||| | ||||||||| |
|
|
| T |
34686977 |
ttcattaatatgattctcaaccgggaaagagggaaatgggggtgtaggtagttgtagaccggtttcag |
34686910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University