View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_447 (Length: 212)
Name: NF8208A_low_447
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_447 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 12122177 - 12122388
Alignment:
| Q |
1 |
gaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122177 |
gaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcattt |
12122276 |
T |
|
| Q |
101 |
ccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaag |
200 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12122277 |
ccgaatataatcttcggaggattgaggttgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaag |
12122376 |
T |
|
| Q |
201 |
ataaggtggggg |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
12122377 |
ataaggtggggg |
12122388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 14691696 - 14691907
Alignment:
| Q |
1 |
gaggctgccataatttgttactgggacccacagacctcaacccagagattctaaaccctaattttatcgtagaagattctcgatctttctggaggcattt |
100 |
Q |
| |
|
||||||||||||||| ||| |||||||||| |||||||| || |||||||||||||||||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
14691696 |
gaggctgccataattgattagtgggacccactgacctcaaaccggagattctaaaccctaatttgatactagaagattctcgatctttctggaggcattt |
14691795 |
T |
|
| Q |
101 |
ccgaatgtaatcttcggaggattgagggtgccatgttcgagaaccaatcttgatgtcgacgacagcggcgttggtgtaattggagacaatatcttctaag |
200 |
Q |
| |
|
||| ||||||||||| ||||| || |||||||||||||| ||||| ||||||||||||||||| || | ||||||||||||| |||||| ||||||||| |
|
|
| T |
14691796 |
ccggatgtaatcttcagaggactgtgggtgccatgttcgtgaaccgatcttgatgtcgacgacggcagggttggtgtaattgctgacaatgtcttctaag |
14691895 |
T |
|
| Q |
201 |
ataaggtggggg |
212 |
Q |
| |
|
| ||||||||| |
|
|
| T |
14691896 |
acgaggtggggg |
14691907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University