View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_448 (Length: 211)
Name: NF8208A_low_448
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_448 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 41 - 131
Target Start/End: Complemental strand, 9534541 - 9534447
Alignment:
| Q |
41 |
atccaatcgaaaataaacatgtattaagatccatgtattattatgcttaactaataagc----taatacttctactagttctagttctggttctt |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9534541 |
atccaatcgaaaataaacatgtattaagatccatgtattattatgcttaactagtaagctaattaatacttgtactagttctagttctggttctt |
9534447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 127 - 171
Target Start/End: Complemental strand, 9534421 - 9534377
Alignment:
| Q |
127 |
ttcttctagttgtgattgaatatttgttcaaccttttttctttca |
171 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
9534421 |
ttcttctagttatgattgaatatttgttcaaccttttctctttca |
9534377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 106
Target Start/End: Original strand, 8301258 - 8301340
Alignment:
| Q |
24 |
acacacgtttaatattcatccaatcgaaaataaacatgtattaagatccatgtattattatgcttaactaataagctaatact |
106 |
Q |
| |
|
||||||||| | ||||||||||| ||||||||||||| | ||||||||| ||| | |||||||||||||| | ||||||| |
|
|
| T |
8301258 |
acacacgttcgagattcatccaatggaaaataaacatgcactaagatccaaagattttcatgcttaactaataggttaatact |
8301340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University