View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_45 (Length: 398)
Name: NF8208A_low_45
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 4e-91; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 97 - 310
Target Start/End: Complemental strand, 1503006 - 1502793
Alignment:
| Q |
97 |
gaaatcaaaatggtaaaaatcgagaggaaaaaagaagtaaatagcatgcagcaatatgcaaaatcaattttannnnnnnngagaggagcattatgcagca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1503006 |
gaaatcaaaatggtaaaaatcgagaggaaaaaagaagtaaatagcatgcagcattatgcaaaatcaatttttttttttttgagaggagcattatgcagca |
1502907 |
T |
|
| Q |
197 |
tcattatcgtaagtaatagtattatgtgatataaggttgatttaatagaagtgagatggtaaggaggttgagagttcaactccactctcaacatagttac |
296 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1502906 |
tcattatcgtaagtaatagtaatatgtaatataaggttgatttaatagaagtgagatggtaaggaggttgagagttcaactccactctcaatatagttac |
1502807 |
T |
|
| Q |
297 |
ataatacaaacaat |
310 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
1502806 |
ataatacaaacaat |
1502793 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 301 - 397
Target Start/End: Complemental strand, 1502635 - 1502525
Alignment:
| Q |
301 |
tacaaacaatattaaatgtagttgcaatgtaaaatcatatta--------------atttgatcttgtattacattgataccacttcttccactccaaca |
386 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1502635 |
tacaaacaatattaaatatagttgcaatgtaaaatcatattagtgtcatactaataatatgatcttgtattacattgataccacttcttccactccaaca |
1502536 |
T |
|
| Q |
387 |
actcgatcgtg |
397 |
Q |
| |
|
||||||||||| |
|
|
| T |
1502535 |
actcgatcgtg |
1502525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 43 - 82
Target Start/End: Complemental strand, 1503202 - 1503163
Alignment:
| Q |
43 |
ataactcaattgacagtgacacttcattgatatatgcaat |
82 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
1503202 |
ataactcaattgacagtaacactttattgatatatgcaat |
1503163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University