View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_454 (Length: 209)
Name: NF8208A_low_454
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_454 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 3601296 - 3601504
Alignment:
| Q |
1 |
gacaaaagaaaagtggatatttgcaacaacaacaaaaatatgtatttaatcttgttggctttggccgccnnnnnnnnnnnnngcaactgtcaaaccaatg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3601296 |
gacaaaagaaaagtggatatttgtaacaacaacaaaaatatgtatttaatcttgttggctttggccgcccttttttttttttgcaactgtcaaaccaatg |
3601395 |
T |
|
| Q |
101 |
atcagggtgtttactattcgtggctcgtttcatgggaaaataatttttgatgaatgcatcactcnnnnnnntataacaaaataaccatacagagctagct |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3601396 |
atcagggtatttactattcgtggctcgtttcatgggaaaataatttttgatgaatgcatcactcaaaaaaatataacaaaataaccatacagagctagct |
3601495 |
T |
|
| Q |
201 |
attcatcaa |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
3601496 |
attcatcaa |
3601504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University