View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_459 (Length: 208)
Name: NF8208A_low_459
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_459 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 141 - 198
Target Start/End: Original strand, 42708954 - 42709011
Alignment:
| Q |
141 |
attggtacctttgtacaataactaaagataaaaataaaataaattaaattctaatttg |
198 |
Q |
| |
|
||||||| |||||||||||||||| || |||||||||||||| |||| ||||||||| |
|
|
| T |
42708954 |
attggtaactttgtacaataactagagcaaaaaataaaataaaataaaatctaatttg |
42709011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 2 - 35
Target Start/End: Complemental strand, 43623931 - 43623898
Alignment:
| Q |
2 |
aaaaacatgcaatcaccgagttaaattgttaatt |
35 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
43623931 |
aaaaacatgcaatcaccgagttaaattggtaatt |
43623898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University