View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_463 (Length: 207)
Name: NF8208A_low_463
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_463 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 21 - 161
Target Start/End: Complemental strand, 22278221 - 22278081
Alignment:
| Q |
21 |
acgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggagtctgggagggtcgagttggtggaaagatatcgtgaggattcgtgttgatg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
22278221 |
acgtctgtggcgaggtacgaagtataaagtgggtgggtgaaggaggggggtctgggagggtcgagttggtggaaggatatcgtgaggattcgtgatgatg |
22278122 |
T |
 |
| Q |
121 |
tcggttttcagggagggagttggtttaatgagaatgtggtg |
161 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
22278121 |
tcggttttcagggagggagttgattcaatgagaatgtggtg |
22278081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University