View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_467 (Length: 206)
Name: NF8208A_low_467
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_467 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 23 - 190
Target Start/End: Original strand, 32450168 - 32450335
Alignment:
| Q |
23 |
tgttagattgcttacttcttttggaggatcaagacacattgtgtgtgtgatatttcattaaaatagattaagattggatgccattttgggtattggggaa |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32450168 |
tgttagattgcttacttcttttggaggatcaagacacattgtgtgtgtgatatttcattaaaatagattaagattggatgccattttgggtattggggaa |
32450267 |
T |
|
| Q |
123 |
attaaatattaaccttatgatcgagtggatcgtcatgttagggacagggggtgcctcgtaaatatatt |
190 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32450268 |
attaaatattaaccttatgaacgagtggatcgtcatgttagggacaggtggtgcctcgtaaatatatt |
32450335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University