View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_475 (Length: 203)
Name: NF8208A_low_475
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_475 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 38930083 - 38929915
Alignment:
| Q |
15 |
gagatgaaattggatgtttctgtcaaaattacttttagcatgaattttattaaactatctacaaatttatgtaatcttttttaagggatcttaatcaaca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38930083 |
gagatgaaattggatgtttctgtcaaaattacttttagcatgaattttattaaactatctacaaatttatgtaatcttttttaagggatcttaatcaaca |
38929984 |
T |
|
| Q |
115 |
ctgtataatggggggaacattattaaaataattattaccattataccttataatgaataatgtttataa |
183 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38929983 |
ctgtctaatggggggaacattattaaaataattattaccattataccttataatgaataatgtttataa |
38929915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University