View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_57 (Length: 376)
Name: NF8208A_low_57
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 25 - 365
Target Start/End: Original strand, 39963901 - 39964240
Alignment:
| Q |
25 |
tacttgtgtcaacgatgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggtt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39963901 |
tacttgtgtcaacgatgtcgcggtgagctgcaacgtcgtcgagggattgaggacgatacttttcaacccatagcgaagctttgccaccgaaggaagggtt |
39964000 |
T |
 |
| Q |
125 |
accggcggcaatgacggttttgcccttgtctgtaacgtcgatgtccatagcataagtctcctccgccatggttattaaaccctaactagtagatcttttt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964001 |
accggcggcaatgacggttttgcccttgtctgtgacgtcgatgtccatagcataagtctcctccgccatggttattaaaccctaactagtagatcttttt |
39964100 |
T |
 |
| Q |
225 |
ctatggtttatgctttgttttctgtgtcactgcgttctcaatttcagaaagaaaatagaaatggtgctatgaattcgatcgaacttgcttctaagtttcc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39964101 |
ctatggtttatgctttgttttctgtgtcactgcgttctcaatttcagaaagaaaatagaaatggtgctatgaattcgatcgaacttgcttctaagtttcc |
39964200 |
T |
 |
| Q |
325 |
cgctcaaaacacagtcttccctgcaaatcttctgtgttact |
365 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
39964201 |
cgctcaaaacacagtcttccctac-aatcttctgtgttact |
39964240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University