View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_86 (Length: 350)
Name: NF8208A_low_86
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_86 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 1 - 347
Target Start/End: Original strand, 2162958 - 2163302
Alignment:
| Q |
1 |
ggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatttgagagtaaaacacatagcccc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2162958 |
ggtagttcttttcctttgactctagaactttgggattgaattaccggtgtatcagtgttttcttttttactgtgaatgtgagagtaaaacacatagcccc |
2163057 |
T |
|
| Q |
101 |
agttaaatcatatattttatttgtgaggacagagtcagtagcggagtggctgttctgaaaagaatttaggttatttctttataaaaagtggtgttagatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2163058 |
agttaaatcatatattttatttgtgaggacagagtcagtagtggagtggctgttctgaaaagaatttaggttatttctttataaaaagcggtgttagatt |
2163157 |
T |
|
| Q |
201 |
ttgatgtcactttttaactattaactggtcttttataactttcgatagtgtatcttgggtcttttcctatagtattccgttgtagatttgccttgcactc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2163158 |
ttgatgtcactttttaactattaactggtcttt--taactttctatagtgtatcttgggtcttttcctattgtattccgttgtagatttgccttgcactc |
2163255 |
T |
|
| Q |
301 |
aatatatggcatgcaatctgtatctggtccctgatattcttcgacat |
347 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||| || |||||||| |
|
|
| T |
2163256 |
aatatatgacatgcaatctgtgtctggtccctgattttattcgacat |
2163302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University