View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208A_low_90 (Length: 349)
Name: NF8208A_low_90
Description: NF8208A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208A_low_90 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 290
Target Start/End: Original strand, 17232572 - 17232854
Alignment:
| Q |
9 |
gaaaagaacatagaaacacaactagtggattaaacccaaatacatcaaagaatttacccaccaacgtttaagatcagaacctaaatttggattatttgct |
108 |
Q |
| |
|
||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
17232572 |
gaaaacaacataaaaacacaactagtggattaaacccaaatacatcaaagaatttacccaccaacgtttaagatcagaacctaaatttggattgtttgct |
17232671 |
T |
 |
| Q |
109 |
ttcaaccaccaataagataacaactttattttatcaaacacatggtcaattgaatttac-ttttgctggaatcaacgataatttcttttcttttagatga |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232672 |
ttcaaccaccaataagataacaactttattttatcaaacacatggtcaattgaatttactttttgctggaatcaacgataatttcttttcttttagatga |
17232771 |
T |
 |
| Q |
208 |
cccatgcacaacctggccaaatagtgcaaaaataatactagattttgcttgagaaaccaccgagtgcgccaaaatatataaca |
290 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17232772 |
cccatgcacaacctagccaaatagtgcaaaaataataccaaattttacttgagaaaccaccgagtgcgccaaaatatataaca |
17232854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 286 - 349
Target Start/End: Original strand, 17233054 - 17233117
Alignment:
| Q |
286 |
taacaaatgccaagcaaaaatcaatacttttaacaggacaactttgttccaagtaatattatga |
349 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17233054 |
taacaaatgccaagcaaaaatcgatacttttaacaggacaactttgttccaaataatattatga |
17233117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University