View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_high_14 (Length: 367)
Name: NF8208_1D_high_14
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 22 - 356
Target Start/End: Original strand, 4591647 - 4591984
Alignment:
| Q |
22 |
aatcagtccaaattttcacatcatgaaaatattaagtatttgaatttgcacaagacaatatctgtcccttgtcttttaacgagggttgtaaaactgtttt |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591647 |
aatcagtccaaattttcacatcatgaaaatattaaatatttgaatttgcacaagacaatatctctcccttgtcttttaacgagggttgtaaaactgtttt |
4591746 |
T |
 |
| Q |
122 |
atacatgcatccaatcaagccatatcataatgccaattgtttaggttacttccttaaatatctcaaaat---ataaacatggggtgatttgataagattc |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
4591747 |
atacatgcatccaatcaagccatgtcataatggcaattgtttaggttacttcctcaaatatctcaaaatataataaacatggggtgatctgataagattc |
4591846 |
T |
 |
| Q |
219 |
tacgcgtaaaaaagctttacaccgtcagtgctcagcaattaatctctgcaaagtatttctgcctaaaagatttgataggattctacatatgatttttatt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4591847 |
aacgcgtaaaaaagctttacaccgtcagttttcagcaattaatctctgcaaagtatttctgcctacaagatttgataggattctacatatgatttttatt |
4591946 |
T |
 |
| Q |
319 |
ttgttttgaaaaaatggatcggatccttcacatgaaca |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4591947 |
ttgttttgaaaaaatggatcggatccttcacatgaaca |
4591984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University