View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_high_23 (Length: 294)
Name: NF8208_1D_high_23
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_high_23 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0024 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 22 - 294
Target Start/End: Complemental strand, 14115 - 13843
Alignment:
| Q |
22 |
caagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcggcagaaggtatgggaaatagtcgcagcag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14115 |
caagcttggatatgaaagtaaggaacgagggactgtgtaaaggttttgtaagtacgtcggctgtttgcgcagcagaaggtatgggaaatagtcgcagcag |
14016 |
T |
|
| Q |
122 |
gccattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgattta |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
14015 |
accattttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagatggctgattta |
13916 |
T |
|
| Q |
222 |
ttgtcgcagaaaacagaagcaggagaagagaaagagaggtgcagatctttaaagaggtacattagccattgca |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13915 |
ttgtcgcagaaaacagaagcaggagaagagaaagagaggtgcagatctttaaagaggtacattagccattgca |
13843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000007; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 138 - 226
Target Start/End: Original strand, 43010780 - 43010867
Alignment:
| Q |
138 |
tctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgatttattgtc |
226 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||| ||||||||||| || ||| |||||| || |||| ||| |||||| |||||| |
|
|
| T |
43010780 |
tctctgatgatgtgacaatctatttcaacgtgtttaatacgttcatggtaa-tggtgttatgggcaaggtcgatgtctgattcattgtc |
43010867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 126 - 218
Target Start/End: Complemental strand, 38825738 - 38825646
Alignment:
| Q |
126 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
218 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
38825738 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
38825646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 126 - 218
Target Start/End: Complemental strand, 46604668 - 46604576
Alignment:
| Q |
126 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
218 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
46604668 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
46604576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 126 - 218
Target Start/End: Original strand, 17881586 - 17881678
Alignment:
| Q |
126 |
ttttgaatcttctctctaatgatgtgacaatctatttcaatgtgtttagtacgttcatggaaactggggttatgtgcgaggtagattgctgat |
218 |
Q |
| |
|
||||||||||| |||||||| | || |||||||| ||||| ||||| ||||| ||||| ||| | |||||||| || || || ||||||||| |
|
|
| T |
17881586 |
ttttgaatcttttctctaattacatggcaatctatctcaatatgttttgtacgctcatgaaaagtagggttatgagcaagataaattgctgat |
17881678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University