View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_high_25 (Length: 281)
Name: NF8208_1D_high_25
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 43 - 272
Target Start/End: Original strand, 50265754 - 50265983
Alignment:
| Q |
43 |
ggtcagtggagtgcaaacactacgggctaacattaggctgtctcccattagcatcgtttcaggaacagagtattataagacaacattaacaaaacattct |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50265754 |
ggtcagtggagtgcaaacactacgggctaacattaggctgtctcccattagcatcgtttcaggaacagagtattataagacaacattaacaaaacattct |
50265853 |
T |
 |
| Q |
143 |
ttggaagtgatatgtagtttgtggccatggatgtggcatgtcactttgttgcgttttgaggccctcataggtcagaatacatctaaatatagaagctttc |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50265854 |
ttggaagtgatatgtagtttgtggccatggatgtggcatgtcactttgttgcgttttgaggccctcataggtcagaatacatctaaatatagaagctttc |
50265953 |
T |
 |
| Q |
243 |
tctggtcttagttgctttttgatgtccatc |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
50265954 |
tctggtcttagttgctttttgatgtccatc |
50265983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University