View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8208_1D_high_30 (Length: 249)

Name: NF8208_1D_high_30
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8208_1D_high_30
NF8208_1D_high_30
[»] chr2 (1 HSPs)
chr2 (92-249)||(44676577-44676732)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 92 - 249
Target Start/End: Original strand, 44676577 - 44676732
Alignment:
92 gagaggtatactagcaaaaacacagatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaact 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44676577 gagaggtatactagcaaaaacacagatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaact 44676676  T
192 tttatgagaaaacatgtgaagaagactgaatagagagatgaagaatgttgaccaagaa 249  Q
    |||||||||||||||||||||||||||||||  |||||||||||||||||||||||||    
44676677 tttatgagaaaacatgtgaagaagactgaat--agagatgaagaatgttgaccaagaa 44676732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University