View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8208_1D_high_36 (Length: 230)

Name: NF8208_1D_high_36
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8208_1D_high_36
NF8208_1D_high_36
[»] chr2 (1 HSPs)
chr2 (57-136)||(44676801-44676881)
[»] chr3 (1 HSPs)
chr3 (19-59)||(34899870-34899910)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 57 - 136
Target Start/End: Original strand, 44676801 - 44676881
Alignment:
57 gaataggaggaatttagcatttgggaagtcacaaatgagaggggaacaaagacgagacaatgagaagac-ttagtgacaag 136  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
44676801 gaataggaggaatttagcatttgggaagtcacaaatgagaggggaacaaagacgagacaatgagaagactttagtgacaag 44676881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 19 - 59
Target Start/End: Original strand, 34899870 - 34899910
Alignment:
19 cacaatttagcttttgttgacatcaaatagcgagagaagaa 59  Q
    |||||||||||||||||||||||||||||||||||||||||    
34899870 cacaatttagcttttgttgacatcaaatagcgagagaagaa 34899910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University