View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_26 (Length: 326)
Name: NF8208_1D_low_26
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_26 |
 | |
|
| [»] scaffold0007 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0007 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 136 - 317
Target Start/End: Complemental strand, 81036 - 80854
Alignment:
| Q |
136 |
ccacataaccacctagaggctatcctagaacaccctaatacacgtctaacaaaaccgaaagcacacaggggcgagaccagcagtacaggcagaaaacaac |
235 |
Q |
| |
|
||||| ||||||||||||||| |||||| ||||||||| ||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
81036 |
ccacagaaccacctagaggctgtcctagcacaccctaacacatgtctaacaaaaccgaaagcacacaggggagagaccagcagtacaggcagaaaacagc |
80937 |
T |
|
| Q |
236 |
-caaaaaatgcagcaggccgcaggaacaaaccgtgacagcatacccgcaaaatgtccccagcaaaactagtgtcgtttcattt |
317 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
80936 |
gaaaaaaatgcactaggccgcaggaacaaaccgtgacagcagccccgcaaaatgtccccagcaaaactagcgtcgtttcattt |
80854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 81151 - 81070
Alignment:
| Q |
22 |
caacatggactacaaaggagctgttaacagaacagctttgctagcaccaaatgaggctgcataacaactgaacaaacagaag |
103 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
81151 |
caacatggagtacaaaggatttgttaacagaacaactttgctagcaccaaatgaggctgcataacaactgaacaaacagaag |
81070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 22 - 102
Target Start/End: Original strand, 4354374 - 4354454
Alignment:
| Q |
22 |
caacatggactacaaaggagctgttaacagaacagctttgctagcaccaaatgaggctgcataacaactgaacaaacagaa |
102 |
Q |
| |
|
||||| ||||||||||||||||| ||||||||||||||||||| ||||||| |||||||||||||| || ||||||||||| |
|
|
| T |
4354374 |
caacagggactacaaaggagctgataacagaacagctttgctatcaccaaacgaggctgcataacagctaaacaaacagaa |
4354454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 136 - 304
Target Start/End: Original strand, 4354484 - 4354655
Alignment:
| Q |
136 |
ccacataaccacctagaggctatcctagaacaccctaatacacgtctaacaaaaccgaaagcacacaggggcgagaccagcagtac-----aggcagaaa |
230 |
Q |
| |
|
||||| |||||| ||| |||| |||||| ||||||||| | | | |||||||||| |||||||||| ||||||||||||||| || ||||||||| |
|
|
| T |
4354484 |
ccacagaaccacgtagtggctgtcctagcacaccctaacataaggctaacaaaactgaaagcacac--gggcgagaccagcagcacatcagaggcagaaa |
4354581 |
T |
|
| Q |
231 |
acaac-caaaaaatgcagcaggccgcaggaacaaaccgtgacagcatacccgcaaaatgtccccagcaaaactag |
304 |
Q |
| |
|
||| | |||||||||||||||||||||||||| ||| |||||||| ||| ||||| || ||||||||||||| |
|
|
| T |
4354582 |
acagcaaaaaaaatgcagcaggccgcaggaacataccatgacagca-gcccccaaaaactcaccagcaaaactag |
4354655 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University