View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_51 (Length: 249)
Name: NF8208_1D_low_51
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_51 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 92 - 249
Target Start/End: Original strand, 44676577 - 44676732
Alignment:
| Q |
92 |
gagaggtatactagcaaaaacacagatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaact |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44676577 |
gagaggtatactagcaaaaacacagatatgatgacaatagcattctttttctgtagacccgtatatatgctctcagattttagatacgggcccattaact |
44676676 |
T |
 |
| Q |
192 |
tttatgagaaaacatgtgaagaagactgaatagagagatgaagaatgttgaccaagaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44676677 |
tttatgagaaaacatgtgaagaagactgaat--agagatgaagaatgttgaccaagaa |
44676732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University