View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_57 (Length: 244)
Name: NF8208_1D_low_57
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_57 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 222
Target Start/End: Complemental strand, 39495617 - 39495413
Alignment:
| Q |
20 |
catcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495617 |
catcagagagtagaaaatagattaatgcatattatatagcagggtgatggtacactactaatgttttatgaatttaacttcatggtttagtgcttatgat |
39495518 |
T |
 |
| Q |
120 |
ttgtgaatacaggcattgtgtagagtatatt--ggtaagctattatgcagtgttaatagtattagtaactgataattacataagttgttatgttagtcat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39495517 |
ttgtgaatacaggcattgtgtagagtatattggggtaagctattatgcagtgtgaatagtattagtaactgataattacataagttgttatgttagtcat |
39495418 |
T |
 |
| Q |
218 |
cgtat |
222 |
Q |
| |
|
||||| |
|
|
| T |
39495417 |
cgtat |
39495413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University