View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_58 (Length: 243)
Name: NF8208_1D_low_58
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_58 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 8 - 237
Target Start/End: Original strand, 3381326 - 3381555
Alignment:
| Q |
8 |
tctattgtatagactagaaccatgaaagatcataaagcatattaccatgatacaggaatcccaaacgattatgtcatatactgaaacctcttaggaatac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3381326 |
tctattgtatagactagaaccatgaaagatcataaagcatattaccatgatacaggaatcccaaacgattatgtcatatactgaaacctcttaggaatac |
3381425 |
T |
|
| Q |
108 |
cacacatactcatgaagatgggagttctacaaattttatttgttaacccttttgtaggattagatcatgaagatctttaaactcatcggacaagaatata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3381426 |
cacacatactcatgaagatgggagttctacaaattttatttgttaacccttttgtaggattagatcatgaagatctttaaactcatcggacaagaatata |
3381525 |
T |
|
| Q |
208 |
tgaacttgttgatacacttgcaacaccaaa |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3381526 |
tgaacttgttgatacacttgcaacaccaaa |
3381555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 197 - 237
Target Start/End: Original strand, 1488840 - 1488880
Alignment:
| Q |
197 |
acaagaatatatgaacttgttgatacacttgcaacaccaaa |
237 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
1488840 |
acaagaatatatgaacttgttggtacaattgcaacaccaaa |
1488880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University