View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_59 (Length: 243)
Name: NF8208_1D_low_59
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 21 - 240
Target Start/End: Complemental strand, 32165628 - 32165409
Alignment:
| Q |
21 |
cagagatcgatttgagatacgtagtggccaatcagacgcgtagctatgagattgtgttggtgtgctccaaattggaaaatgtgtgcatggatttggagaa |
120 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165628 |
cagagatcgatttgagatatgtagtggccaatcagacgcgtagctatgagattgtgttggtgtgctccaaattggaaaatgtgtgcatggatttggagaa |
32165529 |
T |
|
| Q |
121 |
gatgaggaagagaaagatggccctggagagaggttttggaagttggtaggatttgtgatagaggatgaaaagtgggagtgaagaagcgcaaaaacagagt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32165528 |
gatgaggaagagaaagatggccctggagagaggttttggaagttggtaggatttgtgatagaggatgaaaagtgggagtgaagaagcgcaaaaacagagt |
32165429 |
T |
|
| Q |
221 |
gatgtataaatgtgattgca |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
32165428 |
gatgtataaatgtgattgca |
32165409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University