View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_66 (Length: 230)
Name: NF8208_1D_low_66
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_66 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 8 - 230
Target Start/End: Original strand, 32164486 - 32164708
Alignment:
| Q |
8 |
gagatggacatcaacaatactacacatgtcaatgtggcagtttgatcatatctacttttttcatgatcgtgtgtgatcataaagaaaaattaccttctta |
107 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164486 |
gagatggacgtcaacaatactacacatgtcaatgtggcagtttgatcatatctactttgctcatgatcgtgtgtgatcataaagaaaaattaccttctta |
32164585 |
T |
|
| Q |
108 |
acaagcagctggactggttttataatcaccctaccgcagatgtgcatgttctgaaattgagtcttgtaaagctggagataaccgttcaggcataagaatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
32164586 |
acaagcagctggactggttttataatcaccctaccggagatgtgcatgttctgaaaatgagtcttgtaaagctggagataaccgttcaggcataagattc |
32164685 |
T |
|
| Q |
208 |
gaagagcttggcaggagctgatg |
230 |
Q |
| |
|
|||||||||||||| |||||||| |
|
|
| T |
32164686 |
gaagagcttggcagaagctgatg |
32164708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University