View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_69 (Length: 227)
Name: NF8208_1D_low_69
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_69 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 7 - 226
Target Start/End: Original strand, 42080758 - 42080977
Alignment:
| Q |
7 |
ccttccagtttcacaaattgaataacgataaacaattttggttcctaaattactttgccgttcttcgaatcgatagaattcgtttcagcgaaatcgtgta |
106 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42080758 |
ccttccagtttcacaaattgaataactataaacaattttggttcctaaattactttgccgttcttcgaatcgatagaattcgtttcagcgaaatcgtgta |
42080857 |
T |
 |
| Q |
107 |
ttagataacgcgattcttaatggaatcagatttcgagacgaacgatatgctcacactctcacaggattcatttgatgatgccaacgacaatgtaacttcc |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42080858 |
ttagataacgcgattctcaatggaatcagatttcgagacgaacgatatgctcacactctcacaagattcatttgatgatgccaacgacaatgtaacttcc |
42080957 |
T |
 |
| Q |
207 |
tcttattgctctctgtttct |
226 |
Q |
| |
|
|||||||||||||| ||||| |
|
|
| T |
42080958 |
tcttattgctctctctttct |
42080977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University