View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_73 (Length: 219)
Name: NF8208_1D_low_73
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_73 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 32759729 - 32759929
Alignment:
| Q |
19 |
tttatgttttcctatgtttctttgtgtaggtcaactcaagcccttatgaaaatggatggataattaaagttgggatgagtgacagtggtgaacttgacaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
32759729 |
tttatgttttcctatgtttctttgtgtaggtcaactcaagcccttatgaaaatggatggataattaaagttgagatgagtgacagtggcgaacttgacaa |
32759828 |
T |
 |
| Q |
119 |
attgatggattcagaaaagtataccaagttctgtgaagaagaagattccagtcattaatactcttgcggatatctttcaatacttcccatggtatagatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32759829 |
attgatggattcagaaaagtataccaagttctgtgaagaagaagattccagtcattaatactcttgcggatatctttcaatacttcccatggtatagatg |
32759928 |
T |
 |
| Q |
219 |
a |
219 |
Q |
| |
|
| |
|
|
| T |
32759929 |
a |
32759929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University