View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_77 (Length: 209)
Name: NF8208_1D_low_77
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_77 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 3 - 204
Target Start/End: Original strand, 12595321 - 12595523
Alignment:
| Q |
3 |
catcagtgcagacattgctgatgagctgggaattcacctgagtaaacaaa-cnnnnnnnntcaagattattcgtttgttcagtagtgtttaaataggagt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12595321 |
catcagtgcagacattgctgatgagctgggaattcacctgagtaaacaaaacaaaaaaaatcaagattattcgtttgttcaatagtgtttaaataggagt |
12595420 |
T |
|
| Q |
102 |
cacaaccctgataggaaatataccttagaaattgtgtcaaagccaacatttgtttccacaaactggtttttaagatctccattcaaagtcacaggaacac |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12595421 |
cacaaccctgataggaaatataccttagaaattgtgtcaaagccaacatttgtttccacaaactggtttttaagatctccattcaaagtcacaggaacac |
12595520 |
T |
|
| Q |
202 |
caa |
204 |
Q |
| |
|
||| |
|
|
| T |
12595521 |
caa |
12595523 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University