View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_1D_low_82 (Length: 201)
Name: NF8208_1D_low_82
Description: NF8208_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_1D_low_82 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 201
Target Start/End: Complemental strand, 40637179 - 40636992
Alignment:
| Q |
14 |
catcaattcctcttcctctctgattgattggacttcctgtttgagccccgtgacaggtcggtacgaggaggaggctgctggttctggtgctggattgccc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40637179 |
catcaattcctcttcctctctgattgattggacttcctgtttgagccccgtgacaggtcggtacgaggaagaggctgctggttctggtgctggattgccc |
40637080 |
T |
|
| Q |
114 |
tccgtatctctagaaatgtaatcgtgttgttcaacaatccgttgaatcactctctcttcgtgcatgtttatgctttggcacaaacgga |
201 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40637079 |
tccatatctctagaaatgtaaccgtgttgttcaacaatcctttgaatcactctctcttcgtgcatgtttatgctttggcacaaacgga |
40636992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 14 - 85
Target Start/End: Original strand, 40628100 - 40628171
Alignment:
| Q |
14 |
catcaattcctcttcctctctgattgattggacttcctgtttgagccccgtgacaggtcggtacgaggagga |
85 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||| ||||||||||| || |||||||| |
|
|
| T |
40628100 |
catcaattccatttcccttctgattgattggacttcctgtttgagccctgtgacaggtcgatatgaggagga |
40628171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 14 - 87
Target Start/End: Complemental strand, 40658004 - 40657931
Alignment:
| Q |
14 |
catcaattcctcttcctctctgattgattggacttcctgtttgagccccgtgacaggtcggtacgaggaggagg |
87 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| || |||||||||| ||||||| || ||||||||||||| |
|
|
| T |
40658004 |
catcaattccttttcccttctgattgattggactttctctttgagccccatgacaggccgatacgaggaggagg |
40657931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University