View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8208_2D_low_3 (Length: 457)
Name: NF8208_2D_low_3
Description: NF8208_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8208_2D_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 24 - 389
Target Start/End: Original strand, 46628196 - 46628563
Alignment:
| Q |
24 |
ttatttacctatttatttttgttattatta---actttagtctttgatgcttataataccccttgnnnnnnn-taccttagagcatttaaccaacgtttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46628196 |
ttatttacctatttatttttgttattattattaactttagtctttgatgcttat--taccccttgaaaaaaaataccttagagcatttaaccaacgtttc |
46628293 |
T |
 |
| Q |
120 |
tatcaatcactttcccctcaaaggttaacaaaatattcattcattcacctttctctcttatcaacaacccttaacttgaacaaccaacgtgcttttgtta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
46628294 |
tatcaatcactttcccctcaaaggttaacaaaatattcattcattcacctttctctcttatcaacaacccttaacttgatcaaccaacgtgcttttgtta |
46628393 |
T |
 |
| Q |
220 |
ttgtatatgtgtgtgacaaataacattgatttatagggacaaacatgtatactttcaatatttcgattgattgttatccatgaatatgcatgtttgttat |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46628394 |
ttgtatatgtgtgtgacaaataacattgatttatagggacaaacatgtatactttcaatatttcgattgattgttatccatgaatgtgcatgtttgttat |
46628493 |
T |
 |
| Q |
320 |
atcttctgctttccacgatttattttaatcttcatttatttatttacacgttttagttgattcatataag |
389 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46628494 |
atcttctgctttccacgatttattttaatcttcatttatttatttacacgttttagttgattcatataag |
46628563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 151 - 186
Target Start/End: Complemental strand, 15772308 - 15772273
Alignment:
| Q |
151 |
aatattcattcattcacctttctctcttatcaacaa |
186 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15772308 |
aatattcattcattcacgtttctctcttatcaacaa |
15772273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 310 - 356
Target Start/End: Complemental strand, 56085995 - 56085949
Alignment:
| Q |
310 |
tgtttgttatatcttctgctttccacgatttattttaatcttcattt |
356 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||| | ||||||| |
|
|
| T |
56085995 |
tgtttgttatattttctgctttccaccatttattttactgttcattt |
56085949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University