View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8209_low_20 (Length: 241)
Name: NF8209_low_20
Description: NF8209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8209_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 49813825 - 49813603
Alignment:
| Q |
1 |
tggtttatattccttacagnnnnnnntacccagatcttttgatgttaattgaattttgtattagtatggagtaannnnnnngtcttaatggcacagattt |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49813825 |
tggtttatattccttacagaaaaaaatacccagatctttttatgttaattgaattttgtattagtatggagtaatttttt-gtcttaatggcacagattt |
49813727 |
T |
|
| Q |
101 |
atatgaacatttatttattgcagaggagacagggccttttgtagcgtggattgtaggtgcaagcatattttagcggacgaggaagaagctacgaagaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49813726 |
atatgaacatttatttattgcagaggagacagagccttttgtagcgtggattgtaggtgcaagcatattttagcggacgaggaagaagctacgaagaaac |
49813627 |
T |
|
| Q |
201 |
agaacatttttgaagagtgacact |
224 |
Q |
| |
|
|||||||||||||||||| ||||| |
|
|
| T |
49813626 |
agaacatttttgaagagtaacact |
49813603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University