View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8209_low_21 (Length: 217)
Name: NF8209_low_21
Description: NF8209
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8209_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 199
Target Start/End: Complemental strand, 40673412 - 40673228
Alignment:
| Q |
15 |
gtgttcactaatgtttacattacattatattataaatagtagacaaaagaaaacaacgagttcacacacttactcaccagcactagcaaaacaatgtctt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40673412 |
gtgttcactaatgtttacattacattatattataaatagtagacaaaagaaaacaacgagttcacacacttactcaccagcactagcaaaacaatgtctt |
40673313 |
T |
|
| Q |
115 |
cccgtagccaattcttcgcgggtgttataatcttgatagctgccttcattggcagcttattccttagtttattcatcatcagtct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40673312 |
cccgtagccaattcttcgcgggtgttataatcttgatagctgccttcattggcagcttattccttagtttattcatcatcagtct |
40673228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University