View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8210_low_5 (Length: 205)
Name: NF8210_low_5
Description: NF8210
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8210_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 60 - 187
Target Start/End: Original strand, 28390618 - 28390745
Alignment:
| Q |
60 |
ttaggtagatttccttgtttggtccaaataaaatgtgcatggtttttgagcttaacaattattctttgacttataattttttcagttggttgttgataat |
159 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
28390618 |
ttagttagatttccttgtttggtccaaataaaatgtgcttggtttttgaccttaacaattattcttttacttataattttttcagttggttgttgataat |
28390717 |
T |
 |
| Q |
160 |
ggcattatttctgtgtctatggcaagac |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||| |
|
|
| T |
28390718 |
ggcattgtttctgtgtctatggcaagac |
28390745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 94 - 187
Target Start/End: Original strand, 28382139 - 28382232
Alignment:
| Q |
94 |
gtgcatggtttttgagcttaacaattattctttgacttataattttttcagttggttgttgataatggcattatttctgtgtctatggcaagac |
187 |
Q |
| |
|
|||| |||||||||| |||||||| |||||||||||||| | |||||||||||||| |||| ||||||||| |||||||| || || |||||| |
|
|
| T |
28382139 |
gtgcttggtttttgaccttaacaaatattctttgacttacatatttttcagttggttattgacaatggcattgtttctgtgactttgtcaagac |
28382232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 111 - 173
Target Start/End: Complemental strand, 28413228 - 28413167
Alignment:
| Q |
111 |
ttaacaattattctttgacttataattttttcagttggttgttgataatggcattatttctgt |
173 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
28413228 |
ttaacaattattctttgactt-taattttttcagttagttgttgacaatggcattgtttctgt |
28413167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University