View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8211_high_18 (Length: 253)
Name: NF8211_high_18
Description: NF8211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8211_high_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 10252347 - 10252581
Alignment:
| Q |
1 |
tgacgaagaccacactaaattttgtgggacacaactttaataacctgttaattaattgcgttatttcaaacacgcatacaaacaacaaaaagacaaatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10252347 |
tgacgaagaccacactaaattttgtgggacacaactttagtaacctgttaa----ttgcgttatttcaaacacgcatacaaacaacaaaaacacaaatat |
10252442 |
T |
|
| Q |
101 |
tcgaaaattctgagagacaagaaataggtaagaagaacaattattatatatgcacgtatatcatataatcatggataggcttgcttggaagagcaccgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10252443 |
tcgaaaattctgagagacaagaaataggtaagaagaacaattattatatatgcacgtatatcatataatcatggataggcttgcttggaagagcaccgtt |
10252542 |
T |
|
| Q |
201 |
agaccctcataggttcactccacttacattgacattcat |
239 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
10252543 |
agaccctcataggttcactcctcttacaattacattcat |
10252581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University