View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8211_low_12 (Length: 343)
Name: NF8211_low_12
Description: NF8211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8211_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 1e-66; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 1e-66
Query Start/End: Original strand, 57 - 197
Target Start/End: Complemental strand, 37432372 - 37432232
Alignment:
| Q |
57 |
aacttatcgaggcttaagaaatagtttaaagcgtgtctcccgaaaggttatctatccgatgagatctacttcctctctattttattactataagtcgttt |
156 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37432372 |
aacttttcgaggcttaagaaaaagtttaaagcgcgtctcccgaaaggttatctatccgatgagatctacttcctctctattttattactataagtcgttt |
37432273 |
T |
|
| Q |
157 |
tgtcattttcactcattaaaaaatgtgattaattttgtatt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37432272 |
tgtcattttcactcattaaaaaatgtgattaattttgtatt |
37432232 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 262 - 324
Target Start/End: Complemental strand, 37432133 - 37432071
Alignment:
| Q |
262 |
ccttgagtgctttgtggaaagtaaaaccaggtgcattgatggggatagagtacatgcctttag |
324 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37432133 |
ccttgagtgctttgtggaaagtaaaaccaggtgcattgatggggatagagtacatgcctttag |
37432071 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University