View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8211_low_24 (Length: 253)

Name: NF8211_low_24
Description: NF8211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8211_low_24
NF8211_low_24
[»] chr7 (1 HSPs)
chr7 (17-253)||(33675399-33675635)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 17 - 253
Target Start/End: Complemental strand, 33675635 - 33675399
Alignment:
17 agatcaaataaaagagttgacttcagagggagcttttgatttccaaagtgattaatcaagaagaaaaatagcccaactcaacccaaagaatgcgtaagga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33675635 agatcaaataaaagagttgacttcagagggagcttttgatttccaaagtgattaatcaagaagaaaaatagcccaactcaacccaaagaatgcgtaagga 33675536  T
117 attatatacaacggcaagctttgcaagttgcaacaacnnnnnnncagcccagaaagatcaaaggactaattccttttattcatgttacaagataaatgaa 216  Q
    |||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33675535 attatatacaacggcaagctttgcaagttgcaacaacaaaaaaacagcccagaaagatcaaaggactaattccttttattcatgttacaagataaatgaa 33675436  T
217 tagaatcaaatttattatgtatgtaagaattgactgg 253  Q
    |||||||||||||||||||||||||||||||||||||    
33675435 tagaatcaaatttattatgtatgtaagaattgactgg 33675399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University