View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8211_low_27 (Length: 235)
Name: NF8211_low_27
Description: NF8211
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8211_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 30008232 - 30008437
Alignment:
| Q |
14 |
agatgcaacaagttttaagcaatggatatcagtttatggataatggtggcagcagcaatagtagtagttgcttgaagtctgatcaaaaggttgatgaagt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30008232 |
agatgcaacaagttttaagcaatggatatcagtttatggataatggtggcagcagcaacagtagtagttgcttgaagtctgatcaaaaggttgatgaagt |
30008331 |
T |
|
| Q |
114 |
atttgatgctacaaattcttcttcgaccgtaccgataaattcgcttccaaatttggtttctgtttcaccagaatgttctagtgtgaaagagatgatggga |
213 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30008332 |
atttgatgctacaaattcttcttcgacggtaccgataaattcgcttccaaatttggtttctgtttcaccagaatgttctagtgtgaaagagatgatggga |
30008431 |
T |
|
| Q |
214 |
aacaag |
219 |
Q |
| |
|
|||||| |
|
|
| T |
30008432 |
aacaag |
30008437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University