View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_high_24 (Length: 257)
Name: NF8214_high_24
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_high_24 |
 |  |
|
| [»] chr8 (7 HSPs) |
 |  |
|
| [»] chr7 (3 HSPs) |
 |  |
|
| [»] chr5 (9 HSPs) |
 |  |
|
| [»] chr4 (5 HSPs) |
 |  |
|
| [»] chr1 (6 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] chr3 (5 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 30 - 194
Target Start/End: Original strand, 2433081 - 2433250
Alignment:
| Q |
30 |
attattctattcagtattaaccaaatataatagaattttcctaggatttgatacttgggttagtgctaattgcttttgtcattagtatgctattaaccaa |
129 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2433081 |
attatgctattcagtattaaccaaatataatagaattttcctaggatttgatacttgggttagtgctaattgcttttgtcattaatatgctattaaccaa |
2433180 |
T |
 |
| Q |
130 |
atatgagtaattatgtggaatttcctaggatatgatac-----ttaggttagtgctagcttgttttgtta |
194 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2433181 |
atatgagtagttatgtggaatttcctaggatatgatacttaggttaggttagtgctagcttgttttgtta |
2433250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 44 - 168
Target Start/End: Complemental strand, 2677221 - 2677096
Alignment:
| Q |
44 |
tattaaccaaatataatagaattttcctaggatttgatacttgggttagtgctaattgcttttgtcattagtatgctattaaccaaatatgagtaattat |
143 |
Q |
| |
|
|||||| ||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2677221 |
tattaatcaaatataatagaattttcgtaagatatgatacttgggttagtgctaattgcttttgtcattaatatgctattaaccaaatatgagtaattaa |
2677122 |
T |
 |
| Q |
144 |
gtggaa-tttcctaggatatgatact |
168 |
Q |
| |
|
|||||| |||||| ||||||||||| |
|
|
| T |
2677121 |
gtggaattttccttagatatgatact |
2677096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 254
Target Start/End: Complemental strand, 2213361 - 2213321
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgt |
254 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2213361 |
ccgggattctaacttcggaccttgcatatattatgcattgt |
2213321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 220 - 256
Target Start/End: Complemental strand, 10278511 - 10278475
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||||| |
|
|
| T |
10278511 |
ttcgaacttcagatcttgcatatattatgcattgtcc |
10278475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 257
Target Start/End: Complemental strand, 45396628 - 45396585
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
45396628 |
ccgggattcgaacttcagaccttgcatatattatgcattgtcct |
45396585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 224 - 254
Target Start/End: Complemental strand, 5728592 - 5728562
Alignment:
| Q |
224 |
aacttcggagcttgcatatattatgcattgt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5728592 |
aacttcggagcttgcatatattatgcattgt |
5728562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 220 - 254
Target Start/End: Complemental strand, 44019607 - 44019573
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgt |
254 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44019607 |
ttcgaacttcggaccttgcatatattatgcattgt |
44019573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 223 - 256
Target Start/End: Complemental strand, 11709041 - 11709008
Alignment:
| Q |
223 |
gaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
11709041 |
gaacttcggaccttgcatatattatgcattgtcc |
11709008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 256
Target Start/End: Complemental strand, 21557496 - 21557455
Alignment:
| Q |
215 |
cgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
21557496 |
cgggattcgaacctcggaccttacatatattatgcattgtcc |
21557455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 19778126 - 19778086
Alignment:
| Q |
217 |
ggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
19778126 |
ggattcgaaccccggaccttgcatatattatgcattgtcct |
19778086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 220 - 256
Target Start/End: Complemental strand, 44602655 - 44602619
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
44602655 |
ttcgaactccggaccttgcatatattatgcattgtcc |
44602619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 214 - 257
Target Start/End: Complemental strand, 48527254 - 48527211
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
48527254 |
ccgggattcgaactccggaccttgcatatattatgcattgtcct |
48527211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 46987152 - 46987107
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
46987152 |
gtccggggttcgaaccccggaccttgcatatattatgcattgtcct |
46987107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 220 - 256
Target Start/End: Original strand, 33610928 - 33610964
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33610928 |
ttcgaactccggaccttgcatatattatgcattgtcc |
33610964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000009; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 214 - 256
Target Start/End: Original strand, 41778941 - 41778983
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
41778941 |
ccgggattcgaacctcggaccttgcatatattatgcattgtcc |
41778983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 218 - 257
Target Start/End: Complemental strand, 4056850 - 4056811
Alignment:
| Q |
218 |
gattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
4056850 |
gattcgaactccggaccttgcatatattatgcattgtcct |
4056811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 20455955 - 20455913
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
20455955 |
ccgggattcgaaccccggaccttgcatatattatgcattgtcc |
20455913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 223 - 257
Target Start/End: Original strand, 40799600 - 40799634
Alignment:
| Q |
223 |
gaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |
|
|
| T |
40799600 |
gaacttcggaacttgcatatattatgcattgtcct |
40799634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 220 - 257
Target Start/End: Complemental strand, 12124742 - 12124705
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
12124742 |
ttcgaactccggaccttgcatatattatgcattgtcct |
12124705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 24393311 - 24393266
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||| ||||||| || || |||||||||||||||||||||||| |
|
|
| T |
24393311 |
gtccggggttcgaacctcagaccttgcatatattatgcattgtcct |
24393266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 28771648 - 28771603
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
28771648 |
gtccggggttcgaaccgcggatcttgcatatattatgcattgtcct |
28771603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 220 - 256
Target Start/End: Complemental strand, 33064044 - 33064008
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
33064044 |
ttcgaactccggaccttgcatatattatgcattgtcc |
33064008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 220 - 257
Target Start/End: Complemental strand, 32806417 - 32806380
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32806417 |
ttcgaacttcggaccttgcatatattatgcattgtcct |
32806380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 214 - 254
Target Start/End: Original strand, 18278256 - 18278296
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgt |
254 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
18278256 |
ccgggattcgaatttcggaccttgcatatattatgcattgt |
18278296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 212 - 255
Target Start/End: Complemental strand, 35109466 - 35109423
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtc |
255 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| |||||| |
|
|
| T |
35109466 |
gtccgggattcgaacctcggaccttgcatatattatgtattgtc |
35109423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 17046397 - 17046356
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
17046397 |
ccgggattcgaact-cggatcttgcatatattatgcattgtcc |
17046356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 214 - 256
Target Start/End: Complemental strand, 28207196 - 28207154
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
||||||||||||| ||||| ||||||||| ||||||||||||| |
|
|
| T |
28207196 |
ccgggattcgaacctcggaccttgcatattttatgcattgtcc |
28207154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 220 - 257
Target Start/End: Original strand, 8544992 - 8545029
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8544992 |
ttcgaactccggaccttgcatatattatgcattgtcct |
8545029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Original strand, 16531270 - 16531315
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||| ||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
16531270 |
gtccggaattcgaactatggaccttgcatatattatgcattgtcct |
16531315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 11017242 - 11017202
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcatt |
252 |
Q |
| |
|
||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
11017242 |
gtccgggattcgaacctcagaccttgcatatattatgcatt |
11017202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 214 - 254
Target Start/End: Complemental strand, 32339799 - 32339759
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgt |
254 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
32339799 |
ccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000004; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 216 - 257
Target Start/End: Complemental strand, 25978379 - 25978338
Alignment:
| Q |
216 |
gggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
25978379 |
gggattcgaacctcggaccttgcatatattatgcattgtcct |
25978338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 215 - 257
Target Start/End: Complemental strand, 19908755 - 19908713
Alignment:
| Q |
215 |
cgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
19908755 |
cggggttcgaacctcggaccttgcatatattatgcattgtcct |
19908713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 29910527 - 29910482
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||| ||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
29910527 |
gtccggaatttgaacttcagatcttgcatatattatgcattgtcct |
29910482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 214 - 255
Target Start/End: Original strand, 42316821 - 42316862
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtc |
255 |
Q |
| |
|
||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
42316821 |
ccgggattcgaacctcggaccttgcatatattatgcactgtc |
42316862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 220 - 256
Target Start/End: Original strand, 2649736 - 2649772
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
2649736 |
ttcgaactccggaccttgcatatattatgcattgtcc |
2649772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 212 - 257
Target Start/End: Original strand, 38448861 - 38448906
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
38448861 |
gtccgggattcgaaccccggaccttgcatatattatgcattgtcct |
38448906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Complemental strand, 1408501 - 1408456
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
1408501 |
gtccggaattcgaacttcgaactttgcatatattatgcattgtcct |
1408456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 215 - 256
Target Start/End: Complemental strand, 4302515 - 4302474
Alignment:
| Q |
215 |
cgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
||||||| ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
4302515 |
cgggatttgaactccggatcttgcatatattatgcattgtcc |
4302474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Original strand, 6000138 - 6000183
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||| || |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
6000138 |
gtccggggtttgaacctcggaccttgcatatattatgcattgtcct |
6000183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 220 - 257
Target Start/End: Original strand, 9639820 - 9639857
Alignment:
| Q |
220 |
ttcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
9639820 |
ttcgaactccggaccttgcatatattatgcattgtcct |
9639857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 212 - 257
Target Start/End: Original strand, 47528442 - 47528487
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||| ||||||| ||||| ||||| |||||||||||||||||| |
|
|
| T |
47528442 |
gtccggggttcgaacctcggaccttgcgtatattatgcattgtcct |
47528487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 257
Target Start/End: Complemental strand, 75389 - 75346
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
75389 |
ccgggattcgaaccccggaccttgcatatattatgcattgtcct |
75346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 257
Target Start/End: Original strand, 8113559 - 8113602
Alignment:
| Q |
214 |
ccgggattcgaacttcggagcttgcatatattatgcattgtcct |
257 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
8113559 |
ccgggattcgaaccgcggatcttgcatatattatgcattgtcct |
8113602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 14771397 - 14771357
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcatt |
252 |
Q |
| |
|
||||||||||||||| || || ||||||||||||||||||| |
|
|
| T |
14771397 |
gtccgggattcgaacctcagaccttgcatatattatgcatt |
14771357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 256
Target Start/End: Complemental strand, 19468517 - 19468473
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcattgtcc |
256 |
Q |
| |
|
|||| |||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
19468517 |
gtcccggattcgaaccacggaccttgcatatattatgcattgtcc |
19468473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 215 - 255
Target Start/End: Original strand, 46226023 - 46226063
Alignment:
| Q |
215 |
cgggattcgaacttcggagcttgcatatattatgcattgtc |
255 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
46226023 |
cggggttcgaactccggaccttgcatatattatgcattgtc |
46226063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 212 - 252
Target Start/End: Complemental strand, 51614275 - 51614235
Alignment:
| Q |
212 |
gtccgggattcgaacttcggagcttgcatatattatgcatt |
252 |
Q |
| |
|
||||||||||||||| ||||| |||||||||||| |||||| |
|
|
| T |
51614275 |
gtccgggattcgaacctcggaccttgcatatattttgcatt |
51614235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University