View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_high_25 (Length: 253)
Name: NF8214_high_25
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_high_25 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 9026283 - 9026535
Alignment:
| Q |
15 |
atgaatggggcacatgcacattttagctacctaattacagaatttgggagttgtatggatgcaactgttgcagttgagatggaag--------------a |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| | ||||||||||| | |
|
|
| T |
9026283 |
atgaatggggcacatgcacatttcagctacctgattacagaatttgggagctgtatggatgcaactgttgtaactgagatggaagatgatgaagagaaga |
9026382 |
T |
|
| Q |
101 |
tgaagttgatccatgattaggctatccgaatttatttatagtaattggtggacattacatttttcgtgacaagagtgtcaaaatctacgttgatgtgaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
9026383 |
tgaagttgatccatgattaggctatccgaatttatttatagtaattggtggacattacatttttcgtgacaagagtgtcaaaaactacgttgacgtgaca |
9026482 |
T |
|
| Q |
201 |
tatatgtggtatttttgtggtatgaagctggttaacgactttgcatgaggagc |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9026483 |
tatatgtggtatttttgtggtatgaagctggttaacgactttgcatgaggagc |
9026535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University