View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_high_31 (Length: 238)
Name: NF8214_high_31
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_high_31 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 36809175 - 36809394
Alignment:
| Q |
1 |
aaggtgtttgcttctacacattcattatttaattccatatacttttttgaatttggattctacttgtttgttcgttgacaatgacatacatggttcttgg |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
36809175 |
aaggtgtttgcttttacacattcattatttaatcccatatacttttttgaatttggattctacttgtt-gttggttgacaatgacatacatggttcttgg |
36809273 |
T |
|
| Q |
101 |
ccgtccgatatggatcaacgtacaaattatttaattgtgtaaaattcactatgtaatctcaaccgtttgatcttaaattaatgatgaagtaaatgcagca |
200 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36809274 |
ccgtccgatatggatcaatgtataaattatttaattgtgtaaaattcactatgtaatctcaaccgtttgatcttaaattaatgatgaagtaaatgcagca |
36809373 |
T |
|
| Q |
201 |
tattttgatttggctaattta |
221 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
36809374 |
tattttgattttgctaattta |
36809394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University