View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_20 (Length: 326)
Name: NF8214_low_20
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 45540276 - 45540505
Alignment:
| Q |
1 |
tcgttcacaagattcatggatagatagatagaataaagtcaagtcaaccatatacatatattattgaaacttgaaatattaatcattagcgaaataattg |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45540276 |
tcgttcacaagattcatagatagatagatagaataaagtcaagtcaaccatatacatatattattgaaacttgaaacattaatcattagcgaaataattg |
45540375 |
T |
|
| Q |
101 |
attacctgaaggatatgagaattaagcttgacttcactaagctcatatgtcttcgcctcaccgaactgtcaacaatgtttcttgtaaattcaaaacgtct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540376 |
attacctgaaggatatgagaattaagcttgacttcactaagctcatatgtcttcgcctcaccgaactgtcaacaatgtttcttgtaaattcaaaacgtct |
45540475 |
T |
|
| Q |
201 |
ttaacagtctaactaacaacacaagagttc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45540476 |
ttaacagtctaactaacaacacaagagttc |
45540505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 279 - 322
Target Start/End: Original strand, 45540572 - 45540615
Alignment:
| Q |
279 |
cccgtagataaggcgcgaagaaaactaagaataatatagccagg |
322 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
45540572 |
cccgtagataaggcgcgaagaaaactaaaaataaggtagccagg |
45540615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University