View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_21 (Length: 315)
Name: NF8214_low_21
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 20 - 299
Target Start/End: Original strand, 1753701 - 1753994
Alignment:
| Q |
20 |
cacgggagtatacaatgacaactttcgggaactcatgcctgatcgtgcgactgcctcttgaacgtccactggcgcacatatcgcttcttatattaaactt |
119 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
1753701 |
cacgggagtatacaatggcaactttcgggaactcatgcctgatcgtgcgactgcctcttgaacgtccactggtgcacatatcgcttcctatattagactt |
1753800 |
T |
 |
| Q |
120 |
ccattgcaaatcagaatgagtcacctttctcgattcctgctttctttattctaaatttaattcaaaaaatttcaagcagatgtagcata----------- |
208 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1753801 |
ccattgcaagtcagaatgagtcacctttatcgattcctgctttctttattctaaatttaattcaaaaaatttcaaggagatgtagcataaggaatactct |
1753900 |
T |
 |
| Q |
209 |
-----atccatttctgactaatacctatactatatattctcattactaatatgctgtaacattctatacacagccatagacaaaagataaacacac |
299 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1753901 |
atagtatccatttctgact-atacctatactatatattctcattactaatacgctgtaacattctatacacagccatagac-aaagataaacacac |
1753994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University