View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8214_low_30 (Length: 253)

Name: NF8214_low_30
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8214_low_30
NF8214_low_30
[»] chr4 (1 HSPs)
chr4 (15-253)||(9026283-9026535)


Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 15 - 253
Target Start/End: Original strand, 9026283 - 9026535
Alignment:
15 atgaatggggcacatgcacattttagctacctaattacagaatttgggagttgtatggatgcaactgttgcagttgagatggaag--------------a 100  Q
    ||||||||||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||| |  |||||||||||              |    
9026283 atgaatggggcacatgcacatttcagctacctgattacagaatttgggagctgtatggatgcaactgttgtaactgagatggaagatgatgaagagaaga 9026382  T
101 tgaagttgatccatgattaggctatccgaatttatttatagtaattggtggacattacatttttcgtgacaagagtgtcaaaatctacgttgatgtgaca 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||    
9026383 tgaagttgatccatgattaggctatccgaatttatttatagtaattggtggacattacatttttcgtgacaagagtgtcaaaaactacgttgacgtgaca 9026482  T
201 tatatgtggtatttttgtggtatgaagctggttaacgactttgcatgaggagc 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
9026483 tatatgtggtatttttgtggtatgaagctggttaacgactttgcatgaggagc 9026535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University