View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_33 (Length: 242)
Name: NF8214_low_33
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 19 - 197
Target Start/End: Complemental strand, 36685389 - 36685211
Alignment:
| Q |
19 |
attgggaaaatatatttgctccatcatgagcacgaggacacgaatggtaactaatcagatgcacgaattgttacatccgtggctggcgcgcaaagaaatc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36685389 |
attgggaaaatatatttgctccatcatgagcacgaggacacgaatggtaactaatcagatgcacgaattgttacatccgtggctggcgcgcaaagaaatc |
36685290 |
T |
 |
| Q |
119 |
aaagaggtattgtactctctttattaagtactgtatttcttttttaaataaactaccagaaaaaataaccaaatttcag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36685289 |
aaagaggtattgtactctctttattaagtactgtatttcttttttaaataaactaccagaaaaaataaccaaatttcag |
36685211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University