View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_34 (Length: 240)
Name: NF8214_low_34
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 26309635 - 26309842
Alignment:
| Q |
17 |
attctccaaaaacaaatcaatgagattgattgataccatcaataaaaaagaacgattttactatatgatcaacata--tatagtaacattttactgtatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| | |
|
|
| T |
26309635 |
attctccaaaaacaaatcaatgagattgattgataccatcaataaaaaagaacgattttactatatgatcaacatacatatagtaacattttagtgtacc |
26309734 |
T |
 |
| Q |
115 |
agcgtataactctccatgattacgttttaaatggcagatactttgttaattgctaatggaaatcaaataattatggaatattatttacttacttttgact |
214 |
Q |
| |
|
||||| ||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26309735 |
agcgtttaactctacatgattacgttttaaatggcagatactttcttaattgctaatggaaatcaaataattatggaatattatttacttacttttgact |
26309834 |
T |
 |
| Q |
215 |
caatatat |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
26309835 |
caatatat |
26309842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University