View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_35 (Length: 240)
Name: NF8214_low_35
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 9026923 - 9026855
Alignment:
| Q |
17 |
atatataacaagagagaacaaccattttaatttttgactaaaactacaagactcagtttagctcgattc |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9026923 |
atatataacaagagagaacaaccattttaatttttgactaaaactacaagactcagtttagctcgattc |
9026855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 152 - 240
Target Start/End: Complemental strand, 9026788 - 9026693
Alignment:
| Q |
152 |
gggatcacttagtatgtaccctttttgtgttaaccctcc-------agaggaaaaggctatgataattcagagttcggacgagaggtaagtaaagt |
240 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9026788 |
gggatcacttggtacgtaccttttttgtgttaaccctccgattttcagaggaaaaggctatgataattcagagttcggacgggaggtaagtaaagt |
9026693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University