View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8214_low_39 (Length: 230)
Name: NF8214_low_39
Description: NF8214
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8214_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 45540616 - 45540771
Alignment:
| Q |
1 |
gacagaattgttggagtcatttttattagatagaatgaaaaggaatctaaaactgagagcttatatttcttgttgacaattttttcaaataaaaataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540616 |
gacagaattgttggagtcatttttattagatagaatgaaaaggaatctaaaactgagagcttatatttcttgttgacaattttttcaaataaaaataatt |
45540715 |
T |
 |
| Q |
101 |
tgattttgagtgcactcacataaaaaattattattttagaaatataaattattata |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45540716 |
tgattttgagtgcactcacataaaaaattattattttagaaatataaattattata |
45540771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 160 - 217
Target Start/End: Original strand, 45540882 - 45540939
Alignment:
| Q |
160 |
ttttttgttggttgacaatcttatatcgtagtcaaatgaacttatcatttgttgatgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45540882 |
ttttttgttggttgacaatcttatattgtagtcaaatgaacttatcatttgttgatgt |
45540939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University