View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8215_high_2 (Length: 354)
Name: NF8215_high_2
Description: NF8215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8215_high_2 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 354
Target Start/End: Original strand, 46053112 - 46053465
Alignment:
| Q |
1 |
tattattgaaggtttgggagagattgaaaagagaattgagagtggtgaatttaattggagagctgatagagaggatgttcatatgaatattgaagctgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46053112 |
tattattgaaggtttgggagagattgaaaagagaattgagagtggtgaatttaattggagagctgatagagaggatgttcatatgaatattgaagctgca |
46053211 |
T |
|
| Q |
101 |
cttactgatttgattggtgaacctgctaagaagttgcatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgcgatgcta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46053212 |
cttactgatttgattggtgaacctgctaagaagttacatacttccagaagtagaaatgatcaagttgttactgatttacgactctggtgtcgtgatgcta |
46053311 |
T |
|
| Q |
201 |
ttgataagatcttagcaagcataaaacaacttcaagtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgca |
300 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46053312 |
ttgataagatcttagcaagtataaaacaacttcaagtttcgcttcttaagctggctttgaacaatcagggtcttattgttcccggttatactcatttgca |
46053411 |
T |
|
| Q |
301 |
gcgtgcgcagcctgttttattacagcaccttctgcttgcttatgttgaagaggt |
354 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46053412 |
gcgtgcgcaacctgttttattacagcaccttctgcttgcttatgttgaagaggt |
46053465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University