View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8215_low_6 (Length: 242)
Name: NF8215_low_6
Description: NF8215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8215_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 48146358 - 48146541
Alignment:
| Q |
1 |
ctcatgttcttttgggctcaaacttgaagatattattcctccgattgagtcaacatgtgaaaaacagttgttggtgccattccacattaagccctcttca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48146358 |
ctcatgttcttttgggctcaaacttgaagatattattcctccgattgagtcaacatgtgaaaaacggttgttggtgccattccacattaagccctcttca |
48146457 |
T |
 |
| Q |
101 |
ttgttgctcatagaagcagattttggacactttctaacattcctcatgttttctgaaacctacataataaaaccatgatcacaa |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48146458 |
ttgttgctcatagaagcagattttggacactttctaacattcctcgtgttttctgaaacctacataataaaaccatgatcacaa |
48146541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University