View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8215_low_7 (Length: 241)
Name: NF8215_low_7
Description: NF8215
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8215_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 143 - 223
Target Start/End: Complemental strand, 3855702 - 3855622
Alignment:
| Q |
143 |
atgaccaagacgcctataatctttatatatcaatggcgaagtcctttatctttgacagacagcctcctatcaaaacgttaa |
223 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3855702 |
atgaacaagacgcctataatctttatatatcaatggcgaagtcctttatctttgacagacagcctcctatcaaaacattaa |
3855622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 3855803 - 3855695
Alignment:
| Q |
1 |
cgcttgtcaaacaccaaaataaataattttatcaagtattctttgctatttccnnnnnnnaaaataaataaaagggaaataaacatttttatgtataaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3855803 |
cgcttgtcaaacaccaaaataaataattttatcaagtattctttgctatttccttttttta----aaataaaggggaaataaacatttttatgtataaat |
3855708 |
T |
 |
| Q |
101 |
aaattatgaacaa |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3855707 |
aaattatgaacaa |
3855695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University