View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8217_high_13 (Length: 227)
Name: NF8217_high_13
Description: NF8217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8217_high_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 4269121 - 4268906
Alignment:
| Q |
1 |
ttgtttaaaattgcagcacaggacaatacaaatatatttgcccatcgtttgatttaaaaaaggcaacaatggacagcacaaaataagaagcgagggactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269121 |
ttgtttaaaattgcagcacaggacaatacaaatatatttgcccatcgtttgatttaaaaaaggcaacaatggacagcacaaaataagaagcgagggactg |
4269022 |
T |
|
| Q |
101 |
gacaaccaccgttttattgtaccgcacaccaaagcagtggacaaagttttgtcccgagttcaattaagtgcaaaatactattttatcactgtagttagat |
200 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4269021 |
gacaaccaccgttttattgtaccg--caccaaagcagtggacaaagttttgtcccgagttcaattaagtgcaaaatactattttatcactgtagttagat |
4268924 |
T |
|
| Q |
201 |
ctcttggttttttcttct |
218 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
4268923 |
ctcttgtttttttcttct |
4268906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University